Skip to content

Advertisement

  • Short Communication
  • Open Access

Epigallocatechin gallate inhibits sphere formation of neuroblastoma BE(2)-C cells

  • 1, 2Email author,
  • 1,
  • 2,
  • 1,
  • 1, 2,
  • 1, 2,
  • 3,
  • 3,
  • 3,
  • 3,
  • 2,
  • 2,
  • 2,
  • 2,
  • 2,
  • 2,
  • 2,
  • 4 and
  • 1, 2
Environmental Health and Preventive Medicine201117:239

https://doi.org/10.1007/s12199-011-0239-5

  • Received: 9 June 2011
  • Accepted: 16 August 2011
  • Published:

Abstract

Objectives

A growing number of epidemiological studies have demonstrated that the consumption of green tea inhibits the growth of a variety of cancers. Epigallocatechin gallate (EGCG), the most abundant catechin in green tea, has been shown to have an anti-cancer effect against many cancers. Most cancers are believed to be initiated from and maintained by a small population of tumor-initiating cells (TICs) that are responsible for chemotherapeutic resistance and tumor relapse. In neuroblastoma, an aggressive pediatric tumor that often relapses and has a poor prognosis, TICs were recently identified as spheres grown in a serum-free non-adherent culture used for neural crest stem cell growth. Although EGCG has been reported to induce growth arrest and apoptosis in neuroblastoma cells, its effect on neuroblastoma TICs remains to be defined.

Methods

Gene expression was analyzed by real-time reverse transcription polymerase chain reaction (RT-PCR). The effects of EGCG on cell proliferation, apoptosis, and sphere formation were determined by cell counting, propidium iodide staining, and sphere (>100 μm in diameter) counting, respectively.

Results

Neuroblastoma BE(2)-C cells showed increased expression of stem cell markers (nanog homeobox [NANOG] and octamer-binding transcription factor 4 [OCT4]), as well as decreased expression of neuronal differentiation markers (Cu2+-transporting ATPase alpha polypeptide [ATP7A] and dickkopf homolog 2 [DKK2]) in spheres grown in serum-free non-adherent culture, compared to parental cells grown in conventional culture. Although EGCG induced growth arrest and apoptosis in the parental cells in a dose-dependent manner, it was not effective against spheres. However, EGCG potently inhibited sphere formation in the BE(2)-C cells.

Conclusions

The present results suggest that EGCG may inhibit the development of TICs in BE(2)-C cells.

Keywords

  • Epigallocatechin gallate
  • Neuroblastoma
  • Tumor-initiating cell
  • Sphere

Introduction

Green tea is one of the most popular beverages in the world, and receives considerable attention because of its beneficial properties on human health. A growing number of epidemiological studies have demonstrated that the consumption of green tea inhibits the growth of a variety of cancers [1, 2]. In a cohort study in China, tea consumption was inversely associated with colon cancer risk [3]. In a recent pilot study in Japan, green tea extract was also shown to prevent the recurrence of colorectal adenoma, the precursors of most sporadic colorectal cancers, after total endoscopic resection of the preceding lesion [4]. Green tea contains at least four catechins: epigallocatechin gallate (EGCG), epigallocatechin (EGC), epicatechin gallate (ECG), and epicatechin (EC). The anti-cancer effects of EGCG, the most abundant and active catechin in green tea, have been extensively characterized in many cell and animal models and in some human epidemiological studies [5]. Although these studies have revealed multiple signaling pathways targeted by EGCG, the molecular mechanisms of EGCG anti-cancer effects in humans remain to be further investigated.

Neuroblastoma is the most common extracranial solid tumor in children and accounts for ~15% of pediatric cancer deaths [68]. Despite aggressive therapies, <40% of high-risk patients achieve long-term survival. The failure of current therapies is mainly caused by tumor relapse that is lethal in most cases. To achieve better prognosis for high-risk patients, new therapies that can prevent and/or treat tumor relapse are necessary. Accumulating evidence has revealed that a variety of cancers are initiated from and maintained by a small population of tumor-initiating cells (TICs) that generate the bulk of the tumor through continuous self-renewal and differentiation [911]. TICs also show inherent drug resistance that leads to tumor relapse [12, 13]. In neuroblastoma, TICs from a high-risk patient were recently identified as spheres grown in serum-free non-adherent culture used for neural crest stem cell growth and were shown to express stem cell markers, self-renew, and form metastatic tumors in immunodeficient mice [14].

Although EGCG was reported to induce growth arrest and apoptosis in neuroblastoma SH-SY5Y cells, its effect on neuroblastoma TICs remains to be defined [15, 16]. In the present study, we isolated spheres of neuroblastoma BE(2)-C cells and found that EGCG inhibited sphere formation in the BE(2)-C cells.

Materials and methods

Cell culture

Human neuroblastoma BE(2)-C cells were obtained from ATCC (Manassas, VA, USA). For parental cells, BE(2)-C cells were cultured in complete medium (CM), consisting of Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 (Wako Pure Chemical; Osaka, Japan), and 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), at 37°C in a 5% CO2 tissue culture incubator and subcultured with 0.25% trypsin–ethylene diamine tetraacetic acid (EDTA) (Invitrogen). For spheres, BE(2)-C cells were cultured in sphere medium (SM), consisting of DMEM/Ham’s F12 (3:1, Invitrogen), 100 units/ml penicillin/streptomycin (PC/SM; Invitrogen), 2% B27 supplement (Invitrogen), 40 ng/ml basic fibroblast growth factor (bFGF; R&D Systems, Minneapolis, MN, USA), and 20 ng/ml epidermal growth factor (EGF; R&D Systems), at 37°C in a 5% CO2 tissue culture incubator, subcultured with non-enzymatic cell dissociation solution (Sigma, St Louis, MO, USA), and maintained for >4 weeks in ultra-low attachment culture dishes (Corning, Corning, NY, USA). Parental cell and sphere images were acquired using a BZ-9000E microscope (Keyence, Osaka, Japan).

Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR)

Total RNA from parental cells and spheres was isolated with an RNeasy Mini kit (Qiagen, Valencia, CA, USA) and reverse transcribed using a Quantitect Reverse Transcription kit (Qiagen). Real-time PCR analysis was performed with an ABI 7500 Fast Real-time PCR System (Applied Biosystems, Foster City, CA, USA) using FastStart Universal SYBR Green Master (Roche, Mannheim, Germany) according to the manufacturer’s instructions. Each sample was analyzed in triplicate. The relative mRNA expression of nanog homeobox (NANOG; NM_024865), octamer-binding transcription factor 4 (OCT4; NM_002701), Cu2+-transporting ATPase alpha polypeptide (ATP7A; NM_000052), and dickkopf homolog 2 (DKK2; NM_014421) to phosphoglycerate kinase 1 (PGK1; NM_000291) was calculated by the comparative CT method. Primer sequences are shown in Table 1.
Table 1

Real-time polymerase chain reaction (PCR) primers

Gene

Sense primer

Anti-sense primer

Product size (bp)

NANOG

agatgcctcacacggagact

tttgcgacactcttctctgc

127

OCT4

cttcgcaagccctcatttc

gagaaggcgaaatccgaag

88

ATP7A

tcttccaggattgtctgttatgaa

accagcctccgaaaaactg

74

DKK2

ggcagtaagaagggcaaaaa

cctcccaacttcacactcct

72

PGK1

ggagaacctccgctttcat

gctggctcggctttaacc

78

See list of abbreviations for the full names of the genes

Cell proliferation

Parental cells and spheres were seeded into a 24-well plate at a density of 1 × 104 cells per well, treated with 1, 10, 50, and 100 μM (−)-epigallocatechin-3-gallate (EGCG; Wako Pure Chemical) for 48 h, and harvested. The number of cells was counted manually with a KOVA slide (Thermo Fisher Scientific, Waltham, MA, USA). Cell proliferation was defined as the percentage of cells in each sample in relation to a control sample (without EGCG).

Apoptosis

Parental cells and spheres were seeded into a 6-well plate at a density of 5 × 104 cells per well, treated with 1, 10, 50, and 100 μM EGCG for 48 h, and harvested. Collected cells were stained with 1 μg/ml propidium iodide (PI; Sigma) and analyzed with a MoFlo XDP flow cytometer and Summit v5.3 software (Beckman Coulter, Fullerton, CA, USA). Apoptosis was defined as the percentage of PI-positive cells in each sample.

Sphere formation

Parental cells were seeded into a 96-well ultra-low attachment culture plate (Corning) at a density of 1 × 103 cells per well and cultured in SM containing 0, 1, 10, 50, and 100 μM EGCG. Spheres were dissociated every 4–5 days with non-enzymatic cell dissociation solution (Sigma) and examined with a BZ-9000E microscope (Keyence) on days 14–17 (48 h after third passage). Sphere images covering a whole well were merged into a single image using a BZ-9000E microscope (Keyence) and the total number of spheres (>100 μm in diameter) was counted manually.

Results

To examine whether EGCG targeted neuroblastoma TICs, we used a neuroblastoma BE(2)-C cell line. Among the three major neuroblastoma cell types: N (neuroblastic), S (substrate-adherent and non-neuronal), and I (intermediate), BE(2)-C cells have a typical I-type phenotype that most closely resembles neuroblastoma TICs [17, 18]. We first cultured BE(2)-C cells in a serum-free non-adherent condition used for neural crest stem cell growth. In accordance with a previous report [14], BE(2)-C cells efficiently formed spheres (Fig. 1a). We next analyzed the expression of stem cell and neuronal differentiation markers in the spheres, as well as in the parental cells, by a quantitative real-time RT-PCR. Phosphoglycerate kinase 1 (PGK1) was used for normalization, as described previously [19]. Nanog homeobox (NANOG) and octamer-binding transcription factor 4 (OCT4, also known as OCT3 and POU5F1) are commonly used stem cell markers [20], while Cu2+-transporting ATPase alpha polypeptide (ATP7A, also known as MK and MNK) and dickkopf homolog 2 (DKK2) are neuronal differentiation markers characterized in neuroblastoma [21]. Compared to the parental cells, spheres showed increased expression of stem cell markers (NANOG and OCT4) but decreased expression of neuronal differentiation markers (ATP7A and DKK2) (Fig. 1b). These results suggest that spheres of BE(2)-C cells are enriched in neuroblastoma TICs.
Fig. 1
Fig. 1

Spheres from BE(2)-C cells. a BE(2)-C cells were cultured either in a 10% serum adherent condition for 3 days (parental cells) or in a serum-free non-adherent condition over 4 weeks (spheres) and examined by phase-contrast microscopy. The images shown are representative of three independent experiments. Scale bars show 100 μm. b Total RNA was prepared from parental cells and spheres. The relative mRNA expression of nanog homeobox (NANOG), octamer-binding transcription factor 4 (OCT4), Cu2+-transporting ATPase alpha polypeptide (ATP7A), and dickkopf homolog 2 (DKK2) to phosphoglycerate kinase 1 (PGK1) was analyzed by quantitative real-time reverse transcription polymerase chain reaction (RT-PCR). The mean expression in parental cells was set at 1. The data shown are means ± SD of three independent experiments

We then determined cell proliferation in BE(2)-C cells after 0, 1, 10, 50, and 100 μM EGCG treatment by directly counting the cell numbers. Consistent with previous observations in neuroblastoma SH-SY5Y cells, EGCG inhibited cell proliferation in BE(2)-C cells in a dose-dependent manner [22, 23]; 50 μM EGCG caused 93.8 and 25.2% inhibition of cell proliferation in parental cells and spheres, respectively (Fig. 2a). Next we analyzed the percentages of apoptotic cells treated with 0, 1, 10, 50, and 100 μM EGCG, by carrying out PI staining. EGCG also induced apoptosis in BE(2)-C cells in a dose-dependent manner, as reported previously [22, 23]; 50 μM EGCG induced apoptosis in 91.7 and 9.1% of parental cells and spheres, respectively (Fig. 2b). These results suggest that EGCG is not effective in inhibiting cell proliferation and inducing apoptosis in the spheres of BE(2)-C cells compared to the parental cells.
Fig. 2
Fig. 2

Effect of epigallocatechin gallate (EGCG) on cell proliferation and apoptosis of BE(2)-C cells. a Parental cells and spheres were seeded into a 24-well plate and treated with the indicated concentrations of EGCG. After 48 h, the number of cells was counted manually. Cell proliferation was defined as the percentage of cells in each sample in relation to that in a control sample (without EGCG). The data shown are means ± SD of three independent experiments. b Parental cells and spheres were seeded into a 6-well plate, treated with the indicated concentrations of EGCG for 48 h, and stained with propidium iodide (PI). Apoptosis was defined as the percentage of PI-positive cells in each sample analyzed by flow cytometry. The data shown are means ± SD of three independent experiments

We further investigated the effect of EGCG on sphere formation in BE(2)-C cells by culturing the parental cells in a serum-free non-adherent condition for 14–17 days. In marked contrast to the effect of EGCG on cell proliferation and apoptosis of spheres, 50 μM EGCG completely inhibited sphere formation in BE(2)-C cells (Fig. 3). Notably, BE(2)-C cells showed 37.3% inhibition of cell proliferation and 67.2% inhibition of sphere formation in response to 1 μM EGCG (Figs. 2a, 3). These results suggest that EGCG is a potent inhibitor of sphere formation in BE(2)-C cells.
Fig. 3
Fig. 3

Effect of EGCG on sphere formation in BE(2)-C cells. Parental cells were seeded into a 96-well plate, cultured in sphere medium (SM) containing the indicated concentrations of EGCG for 14–17 days, and examined by bright-field microscopy. The number of spheres (>100 μM in diameter) was counted manually. Sphere formation was defined as the percentage of spheres in each sample in relation to that in a control sample (without EGCG). The data shown are means ± SD of three independent experiments

Discussion

In the present study, we isolated spheres of neuroblastoma BE(2)-C cells and obtained two novel findings. First, EGCG was not effective in inhibiting cell proliferation or in inducing apoptosis in the spheres of BE(2)-C cells compared to the parental cells. Second, EGCG potently inhibited sphere formation in BE(2)-C cells. As sphere formation likely represents the development of TICs leading to tumor relapse, EGCG may be effective in preventing recurrence of neuroblastoma.

To target TICs, several therapeutic strategies have been suggested [13]. Inhibiting the key signaling pathways active in TICs is one of the most promising strategies. Hedgehog, Notch, and Wnt signaling pathways are essential to regulate the self-renewal of TICs and are aberrantly activated in a variety of cancers [12]. An increasing number of studies have revealed that several dietary compounds have potential to act against the self-renewal of TICs [24]. For example, curcumin is a well-known polyphenol present in the Indian spice turmeric and has been shown to target TICs, through its inhibitory effect on Wnt signaling, in breast cancer [25]. A dietary component of broccoli/broccoli sprouts, sulforaphane, has also been demonstrated to be effective in targeting breast cancer TICs and down-regulating Wnt signaling [26]. Potential signaling pathways targeted by EGCG in neuroblastoma are currently under investigation.

Neuroblastoma develops from primitive neural crest cells that normally differentiate into the sympathoadrenal lineage. Although the exact targets of transformation during neuroblastoma progression remain to be defined, TICs undergoing self-renewal as well as multi-lineage differentiation were isolated as spheres grown in serum-free non-adherent culture [14]. Consistent with the inherent drug-resistance of TICs, the ineffectiveness of EGCG in inducing growth arrest and apoptosis was detected in spheres of BE(2)-C cells (Fig. 2). In contrast, sphere formation in BE(2)-C cells was sensitive to EGCG (Fig. 3). Because the EGCG-induced growth arrest and apoptosis of parental cells also affects sphere formation, it will be crucial to clarify the molecular basis behind the EGCG-sensitive sphere formation in BE(2)-C cells.

Although the existence of TICs in most cancers is now widely accepted, it is currently unclear whether TICs arise directly from the transformation of normal stem/progenitor cells or whether they are derived from the de-differentiation of more mature transformed cells. Using H3K4 demethylase JARID1B as a marker for melanoma TICs, JARID1B-negative cells (non-TICs) were shown to become positive (TICs) [27]. In breast cancer, non-TICs were also demonstrated to de-differentiate into TICs [28]. Furthermore, the conversion of non-TICs into TICs was found to be regulated by interleukin (IL)-6 in breast and prostate cancer cells [29]. Accordingly, it is tempting to speculate that TICs may be generated from non-TICs in neuroblastoma [30]. In summary, the present study supports the further evaluation of EGCG as a dietary compound targeting neuroblastoma.

Abbreviations

EGCG: 

Epigallocatechin gallate

TIC: 

Tumor-initiating cell

NANOG: 

Nanog homeobox

OCT4: 

Octamer-binding transcription factor 4

ATP7A: 

Cu2+-transporting ATPase alpha polypeptide

DKK2: 

Dickkopf homolog 2

PGK1: 

Phosphoglycerate kinase 1

Declarations

Acknowledgments

This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and grants from the Showa-hokokai and the Hyogo Prefecture Health Promotion Association.

Conflict of interest

The authors declare no conflict of interest.

Authors’ Affiliations

(1)
Department of Epidemiology, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan
(2)
Department of Pediatrics, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan
(3)
Department of Hematology and Oncology, Hyogo Children’s Hospital, Kobe, Japan
(4)
Department of Medical Rehabilitation, Kobe Gakuin University, Kobe, Japan

References

  1. Ju J, Lu G, Lambert JD, Yang CS. Inhibition of carcinogenesis by tea constituents. Semin Cancer Biol. 2007;17:395–402.PubMedView ArticleGoogle Scholar
  2. Yang CS, Wang X, Lu G, Picinich SC. Cancer prevention by tea: animal studies, molecular mechanisms and human relevance. Nat Rev Cancer. 2009;9:429–39.PubMedView ArticleGoogle Scholar
  3. Yuan J-M, Gao Y-T, Yang CS, Yu MC. Urinary biomarkers of tea polyphenols and risk of colorectal cancer in the Shanghai Cohort Study. Int J Cancer. 2007;120:1344–50.PubMedView ArticleGoogle Scholar
  4. Shimizu M, Fukutomi Y, Ninomiya M, Nagura K, Kato T, Araki H, et al. Green tea extracts for the prevention of metachronous colorectal adenomas: a pilot study. Cancer Epidemiol Biomarkers Prev. 2008;17:3020–5.PubMedView ArticleGoogle Scholar
  5. Khan N, Mukhtar H. Multitargeted therapy of cancer by green tea polyphenols. Cancer Lett. 2008;269:269–80.PubMedView ArticleGoogle Scholar
  6. Brodeur GM. Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer. 2003;3:203–16.PubMedView ArticleGoogle Scholar
  7. Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet. 2007;369:2106–20.PubMedView ArticleGoogle Scholar
  8. Janoueix-Lerosey I, Schleiermacher G, Delattre O. Molecular pathogenesis of peripheral neuroblastic tumors. Oncogene. 2010;29:1566–79.PubMedView ArticleGoogle Scholar
  9. Jordan CT, Guzman ML, Noble M. Cancer stem cells. N Engl J Med. 2006;355:1253–61.PubMedView ArticleGoogle Scholar
  10. Visvader JE, Lindeman GJ. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 2008;8:755–68.PubMedView ArticleGoogle Scholar
  11. Alison MR, Islam S, Wright NA. Stem cells in cancer: instigators and propagators? J Cell Sci. 2010;123:2357–68.PubMedView ArticleGoogle Scholar
  12. Liu S, Dontu G, Wicha MS. Mammary stem cells, self-renewal pathways, and carcinogenesis. Breast Cancer Res. 2005;7:86–95.PubMedView ArticleGoogle Scholar
  13. Zhou B-BS, Zhang H, Damelin M, Geles KG, Grindley JC, Dirks PB. Tumour-initiating cells: challenges and opportunities for anticancer drug discovery. Nat Rev Drug Discov. 2009;8:806–23.PubMedView ArticleGoogle Scholar
  14. Hansford LM, McKee AE, Zhang L, George RE, Gerstle JT, Thorner PS, et al. Neuroblastoma cells isolated from bone marrow metastases contain a naturally enriched tumor-initiating cell. Cancer Res. 2007;67:11234–43.PubMedView ArticleGoogle Scholar
  15. Das A, Banik NL, Ray SK. Retinoids induce differentiation and downregulate telomerase activity and N-Myc to increase sensitivity to flavonoids for apoptosis in human malignant neuroblastoma SH-SY5Y cells. Int J Oncol. 2009;34:757–65.PubMedGoogle Scholar
  16. Das A, Banik NL, Ray SK. Mechanism of apoptosis with the involvement of calpain and caspase cascades in human malignant neuroblastoma SH-SY5Y cells exposed to flavonoids. Int J Cancer. 2006;119:2575–85.PubMedView ArticleGoogle Scholar
  17. Ross RA, Spengler BA. Human neuroblastoma stem cells. Semin Cancer Biol. 2007;17:241–7.PubMedView ArticleGoogle Scholar
  18. Ross RA, Biedler JL, Spengler BA. A role for distinct cell types in determining malignancy in human neuroblastoma cell lines and tumors. Cancer Lett. 2003;197:35–9.PubMedView ArticleGoogle Scholar
  19. Nishimura N, Pham TVH, Hartomo TB, Lee MJ, Hasegawa D, Takeda H, et al. Rab15 expression correlates with retinoic acid-induced differentiation of neuroblastoma cells. Oncol Rep. 2011;26:145–51.PubMedGoogle Scholar
  20. Melone MAB, Giuliano M, Squillaro T, Alessio N, Casale F, Mattioli E, et al. Genes involved in regulation of stem cell properties: studies on their expression in a small cohort of neuroblastoma patients. Cancer Biol Ther. 2009;8:1300–6.PubMedView ArticleGoogle Scholar
  21. Hahn CK, Ross KN, Warrington IM, Mazitschek R, Kanegai CM, Wright RD, et al. Expression-based screening identifies the combination of histone deacetylase inhibitors and retinoids for neuroblastoma differentiation. Proc Natl Acad Sci USA. 2008;105:9751–6.PubMedView ArticleGoogle Scholar
  22. Hsieh T-C, Wu JM. Targeting CWR22Rv1 prostate cancer cell proliferation and gene expression by combinations of the phytochemicals EGCG, genistein and quercetin. Anticancer Res. 2009;29:4025–32.PubMedGoogle Scholar
  23. Kürbitz C, Heise D, Redmer T, Goumas F, Arlt A, Lemke J, et al. Epicatechin gallate and catechin gallate are superior to epigallocatechin gallate in growth suppression and anti-inflammatory activities in pancreatic tumor cells. Cancer Sci. 2011;102:728–34.PubMedView ArticleGoogle Scholar
  24. Kawasaki BT, Hurt EM, Mistree T, Farrar WL. Targeting cancer stem cells with phytochemicals. Mol Interv. 2008;8:174–84.PubMedView ArticleGoogle Scholar
  25. Kakarala M, Brenner DE, Korkaya H, Cheng C, Tazi K, Ginestier C, et al. Targeting breast stem cells with the cancer preventive compounds curcumin and piperine. Breast Cancer Res Treat. 2010;122:777–85.PubMedView ArticleGoogle Scholar
  26. Li Y, Zhang T, Korkaya H, Liu S, Lee H-F, Newman B, et al. Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells. Clin Cancer Res. 2010;16:2580–90.PubMedView ArticleGoogle Scholar
  27. Roesch A, Fukunaga-Kalabis M, Schmidt EC, Zabierowski SE, Brafford PA, Vultur A, et al. A temporarily distinct subpopulation of slow-cycling melanoma cells is required for continuous tumor growth. Cell. 2010;141:583–94.PubMedView ArticleGoogle Scholar
  28. Chaffer CL, Brueckmann I, Scheel C, Kaestli AJ, Wiggins PA, Rodrigues LO, et al. Normal and neoplastic nonstem cells can spontaneously convert to a stem-like state. Proc Natl Acad Sci USA. 2011;108:7950–5.PubMedView ArticleGoogle Scholar
  29. Iliopoulos D, Hirsch HA, Wang G, Struhl K. Inducible formation of breast cancer stem cells and their dynamic equilibrium with non-stem cancer cells via IL6 secretion. Proc Natl Acad Sci USA. 2011;108:1397–402.PubMedView ArticleGoogle Scholar
  30. Castellanos A, Vicente-Dueñas C, Campos-Sánchez E, Cruz JJ, García-Criado FJ, García-Cenador MB, et al. Cancer as a reprogramming-like disease: implications in tumor development and treatment. Semin Cancer Biol. 2010;20:93–7.PubMedView ArticleGoogle Scholar

Copyright

© The Japanese Society for Hygiene 2011

Advertisement