Skip to main content

Table 1 Primer sequences

From: Circular RNA profiles in mouse lung tissue induced by radon

Gene Sequence (5’-3’)
GAPDH F:5’GTTGTCTCCTGCGACTTCA3’
R:5’GCCCCTCCTGTTATTATGG3’
mmu_circ_0001028 F:5’ TATTCTTCTGGGTGAGGATGGC3’
R:5’ TTGATCCGCTTTATGGCTACG3’
mmu_circ_0001311 F:5’ CCCCAGGATCTTCGTAGGTTA3’
R:5’ TCTTTCTTCCTTCAGCCACTTC3’
mmu_circ_0001154 F:5’ TCTGGAACATTGCGATTTGGA 3’
R:5’ TTGTTGACCGATGCCCACTC3’
mmu_circ_0001052 F:5’ CCGTACAGGGTTAAAGTGATAG3’
R:5’ TTTGATAAACATACGGTGGGT3’
mmu_circ_0001796 F:5’ GTCCGTACCCGATCAGTTGG 3’
R:5’ CGTTCTCAGACCTGCCTCCT 3’